|
Guide RNA (gRNA) is a type of RNA that is used in mRNA editing. // Introduction The term RNA editing describes those molecular processes in which the information content is altered in a RNA molecule through a chemical change in the base makeup. ...
Overview of gRNA-mediated editing The mitochondria for some trypanosome protozoa undergo gRNA-mediated mRNA editing. The gRNA identifies particular sequences and inserts or deletes Uridine (U) nucleotides. The edited portion of the mRNA is in the coding region, which has the effect of modifying the protein that is produced. Genera Blastocrithidia Crithidia Endotrypanum Herpetomonas Leishmania Leptomonas Phytomonas Trypanosoma Wallaceina Trypanosomes are a group of kinetoplastid protozoa distinguished by having only a single flagellum. ...
Example of gRNA-mediated editing In the protozoan, Leishmania tarentolae, some mitochondrial genes are edited using this process. One such gene is Cyb.[1] While the exact sequence of events is still understudy, one model has that the mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is Species see text Leishmania is a genus of trypanosome protozoa, and is the parasite responsible for the disease leishmaniasis. ...
mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3' The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) with normal basepairing (some G/U pairs are used). The 5' end does not exactly match and an endonuclease makes cuts in the mRNA to allow for alignment. gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' A A AGAAA A G G C UUUAACUUCAGGUUGU 3' The mRNA is now "repaired" by adding U, giving the sequence gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3' This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA).
Notes - ^ See [1] (Accessed 19 May 2006) for details.
|