FACTOID # 57: In 2002, every 1000 Swedes made a bus.
 
 Home   Encyclopedia   Statistics   Countries A-Z   Flags   Maps   Education   Forum   FAQ   About 
 
WHAT'S NEW
RELATED ARTICLES
People who viewed "Telomere" also viewed:
RECENT ARTICLES
More Recent Articles »
 

FACTS & STATISTICS    Simple view

  1. Select countries to view: (hold down Control key and click to select several)

     

     

    Compare:

     

     

  1. Select fact or statistic: (* = graphable)

     

     

     

  2. (OPTIONAL) Compare to statistic: (both need to be graphable)

     

     

     

  3. View result as:

     

       
(OR) SEARCH ALL encyclopedia, stats & forums:   

Encyclopedia > Telomere

A telomere is a region of highly repetitive DNA at the end of a linear chromosome that functions as a disposable buffer. Every time linear chromosomes are replicated during late S phase, the DNA polymerase complex is incapable of replicating all the way to the end of the chromosome; if it were not for telomeres, this would quickly result in the loss of vital genetic information, which is needed to sustain a cell's activities. Every time a cell with linear chromosomes divides, it will lose a small piece of one of its strands of DNA. This process has been referred to by James Watson and Alexei Olovnikov as the "end replication problem" (1971). It is believed that telomeres have a function in the ageing process. The structure of part of a DNA double helix Deoxyribonucleic acid, or DNA, is a nucleic acid molecule that contains the genetic instructions used in the development and functioning of all known living organisms. ... Figure 1: A representation of a condensed eukaryotic chromosome, as seen during cell division. ... DNA replication. ... DNA replication. ... 3D structure of the DNA-binding helix-hairpin-helix motifs in human DNA polymerase beta A DNA polymerase is an enzyme that assists in DNA replication. ... A DNA sequence (sometimes genetic sequence) is a succession of letters representing the primary structure of a real or hypothetical DNA molecule or strand, The possible letters are A, C, G, and T, representing the four nucleotide subunits of a DNA strand (adenine, cytosine, guanine, thymine), and typically these are... Drawing of the structure of cork as it appeared under the microscope to Robert Hooke from Micrographia which is the origin of the word cell being used to describe the smallest unit of a living organism Cells in culture, stained for keratin (red) and DNA (green) The cell is the... James Dewey Watson (born April 6, 1928) is an American molecular biologist, best known as one of the co-discoverers of the structure of DNA. Watson, Francis Crick, and Maurice Wilkins were awarded the 1962 Nobel Prize in Physiology or Medicine for their discoveries concerning the molecular structure of nucleic... The effects of ageing on a human face Elderly woman Ageing or aging is the process of systems deterioration with time. ...

Contents

Nature and function of telomeres

Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence which acts to protect the terminal ends of chromosomes. This is because during replication, DNA polymerase can only synthesize DNA in a 5' to 3' direction and can only do so by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. At the terminal of the DNA strand, the RNA primer is laid but DNA polymerase cannot extend beyond it. This RNA primer will not later be replaced by DNA, and therefore cannot be translated into gene products or replicated later. Without telomeres at the end of DNA, this genetic sequence would be deleted and the chromosome would grow shorter and shorter in subsequent replications. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerases, part of a protein subgroup of specialized reverse transcriptase enzymes known as TERT (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms and because TERT expression is repressed in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cells and certain white blood cells, TERT is expressed and telomere length is maintained. Telomerase is an enzyme that adds specific DNA sequence repeats (TTAGGG in all vertebrates) to the 3 (three prime) end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. ... Telomerase is an enzyme that adds specific DNA sequence repeats (TTAGGG in all vertebrates) to the 3 (three prime) end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. ... In biochemistry, a reverse transcriptase, also known as RNA-dependent DNA polymerase, is a DNA polymerase enzyme that transcribes single-stranded RNA into double-stranded DNA. Normal transcription involves the synthesis of RNA from DNA, hence reverse transcription is the reverse of this. ... TERT is an acronym for TElomerase Reverse Transcriptase, a protein subgroup. ... Mouse embryonic stem cells with fluorescent marker. ... White Blood Cells redirects here. ...

Structure of parallel quadruplexes that can be formed by human telomeric DNA. Image created from NDB UD0017.
Structure of parallel quadruplexes that can be formed by human telomeric DNA. Image created from NDB UD0017.

In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich. These GC-rich sequences can form four-stranded structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each other with either a sodium or potassium ion between the planar quadruplexes. Image File history File links Size of this preview: 658 × 600 pixelsFull resolution (1316 × 1200 pixel, file size: 1. ... Image File history File links Size of this preview: 658 × 600 pixelsFull resolution (1316 × 1200 pixel, file size: 1. ... This article is about modern humans. ... A unit of measurement in molecular biology denoting a length of 1000 nucleotides (bases) of DNA or RNA. Categories: | ... Nucleic acid sequences which are rich in guanine are capable of forming four-stranded structures called G-quadruplexes (Also known as G-tetrads or G4-DNA). ...


In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions. Prokaryotic bacteria cell structure Prokaryotes (IPA: //) are a group of organisms that lack a cell nucleus (= karyon), or any other membrane-bound organelles. ... DNA replication. ... Phyla Actinobacteria Aquificae Chlamydiae Bacteroidetes/Chlorobi Chloroflexi Chrysiogenetes Cyanobacteria Deferribacteres Deinococcus-Thermus Dictyoglomi Fibrobacteres/Acidobacteria Firmicutes Fusobacteria Gemmatimonadetes Lentisphaerae Nitrospirae Planctomycetes Proteobacteria Spirochaetes Thermodesulfobacteria Thermomicrobia Thermotogae Verrucomicrobia Bacteria (singular: bacterium) are unicellular microorganisms. ... Streptomyces is a genus of Actinobacteria. ... Species Borrelia anserina Borrelia burgdorferi Borrelia is a genus of bacteria of the spirochete class. ...


In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. A germ cell is part of the germline and is involved in the reproduction of organisms. ... In biology, senescence is the combination of processes of deterioration which follow the period of development of an organism. ... Cancer is a class of diseases or disorders characterized by uncontrolled division of cells and the ability of these to spread, either by direct growth into adjacent tissue through invasion, or by implantation into distant sites by metastasis (where cancer cells are transported through the bloodstream or lymphatic system). ...


If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and will enter cellular senescence, growth arrest or apoptosis depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence. In biology, senescence is the combination of processes of deterioration which follow the period of development of an organism. ... A section of mouse liver showing an apoptotic cell indicated by an arrow Apoptosis (pronounced apo tō sis) is a process of suicide by a cell in a multicellular organism. ... A section of mouse liver showing an apoptotic cell indicated by an arrow Apoptosis (pronounced apo tō sis) is a process of suicide by a cell in a multicellular organism. ...


At the very distal end of the telomere is a 300 bp single-stranded portion which forms the T-Loop. This loop is analogous to a 'knot' which stabilizes the telomere; preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins; most notably TRF1, TRF2, POT1, TIN1, and TIN2, collectively referred to as the shelterin complex.


A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.


Telomere shortening

Lagging strand during DNA replication
Lagging strand during DNA replication

"Telomeres" shorten because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated. I, the creator of this image, hereby release it into the public domain. ... I, the creator of this image, hereby release it into the public domain. ... Kingdoms Animalia - Animals Fungi Plantae - Plants Chromalveolata Protista Alternative phylogeny Unikonta Opisthokonta Metazoa Choanozoa Eumycota Amoebozoa Bikonta Apusozoa Cabozoa Rhizaria Excavata Corticata Archaeplastida Chromalveolata Animals, plants, fungi, and protists are eukaryotes (IPA: ), organisms whose cells are organized into complex structures by internal membranes and a cytoskeleton. ... 3D structure of the DNA-binding helix-hairpin-helix motifs in human DNA polymerase beta A DNA polymerase is an enzyme that assists in DNA replication. ... A diagram of a furanose (sugar-ring) molecule with carbons labelled numerically Directionality, in molecular biology, refers to the end-to-end chemical orientation of a single strand of nucleic acid. ...


On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand. Left: An RNA strand, with its nitrogenous bases. ... A primer is a nucleic acid strand, or a related molecule that serves as a starting point for DNA replication. ... This article does not cite any references or sources. ...


Eventually, the last RNA primer attaches, and DNA polymerase and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication at the 5' end of both the leading and lagging strands. It has been suggested that sticky end/blunt end be merged into this article or section. ...


Extending telomeres

The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were made by the team led by Professor Elizabeth Blackburn at the University of California - San Francisco. Leonard Hayflick (born in 1928), Ph. ... The Hayflick limit was discovered by Leonard Hayflick in 1965. ... Elizabeth (Liz) H(elen) Blackburn (November 26, 1948 - ) is a professor of biology and leading researcher in the field of the telomere and the telomerase enzyme, and their relationships to aging and cancer. ... Berkeley Davis Irvine Los Angeles Merced Riverside San Diego Santa Barbara Santa Cruz UC Office of the President in Oakland The University of California (UC) is a public university system in the state of California. ...


Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans. Life extension refers to an increase in maximum or average lifespan, especially in humans, by slowing down or reversing the processes of aging. ... Gene therapy is the insertion of genes into an individuals cells and tissues to treat a disease, and hereditary diseases in which a defective mutant allele is replaced with a functional one. ...


However, it has been hypothesized that there is a trade-off between cancerous tumor suppression and tissue repair capacity, in that lengthening telomeres might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).


A study done with the nematode worm species Caenorhabditis elegans indicates that there is a correlation between lengthening telomeres and a longer lifespan. Two groups of worms were studied which differed in the amount of the protein HRP-1 their cells produced, resulting in telomere lengthening in the mutant worms. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the normal worms. A side effect of the mutation was an increased resistance to the effects of heat exposure. The reasons for that effect are unclear. (Joeng et al., 2004). Classes Adenophorea    Subclass Enoplia    Subclass Chromadoria Secernentea    Subclass Rhabditia    Subclass Spiruria    Subclass Diplogasteria    Subclass Tylenchia The nematodes or roundworms (Phylum Nematoda from Greek (nema): thread + -ode like) are one of the most common phyla of animals, with over 20,000 different described species (over 15,000 are parasitic). ... Binomial name Maupas, 1900 Caenorhabditis elegans (IPA: ) is a free-living nematode (roundworm), about 1 mm in length, which lives in temperate soil environments. ... Positive linear correlations between 1000 pairs of numbers. ... A representation of the 3D structure of myoglobin, showing coloured alpha helices. ...


Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs. Tissue engineering is the use of a combination of cells, engineering and materials methods, and suitable biochemical and physio-chemical factors to improve or replace biological functions. ...


However, there are several issues that still need to be cleared up. First, it is not even certain whether the relationship between telomeres and aging is causal. Although this is indeed probably so because changing telomere lengths are usually associated with changing speed of senescence, the relationship may well be the other way around, with telomere shortening a consequence of and not a reason for aging. That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabirds: A causal system is a system that depends only on the current and previous inputs. ... The Sooty Tern is highly aerial and marine and will spend years flying at sea without returning to land. ...


In 2003, scientists observed that the telomeres of Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres[1]. In 2006, Juola et al. reported that in another, unrelated long-lived seabird species, the Great Frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed, and more research into the topic is clearly warranted before any firm conclusions can be drawn or even practical applications tested. Binomial name Oceanodroma leucorhoa (Vieillot, 1818) The Leachs Storm-petrel or Leachs Petrel (Oceanodroma leucorhoa) is a small seabird of the tubenose family. ... Binomial name Fregata minor (Gmelin, 1789) The Great Frigatebird (Fregata minor), also known as the Iwa, is a migratory seabird in the frigatebird family. ... Species Fregata magnificens Fregata aquila Fregata andrewsi Fregata minor Fregata ariel There are five species in the family Fregatidae, the frigatebirds. ...


Telomere Length Assay

Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane; and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method involves fluorescent in situ hybridization (FISH). These methods however, require significant amounts of genomic DNA (2-20 micrograms) and labor which renders its use limited in large epidemiological studies. Some of these impediments have been overcome with a Real-Time PCR assay for telomere length. This assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio which is demonstrated to be proportional to the average telomere length in a cell. The Real-Time PCR assay has been since upscaled to high-throughput 384-well format use; making the assay feasible for use in large cohort studies.


Telomere sequences

Some known telomere sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungi Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

This article does not cite any references or sources. ... This article is about modern humans. ... Binomial name Mus musculus Linnaeus, 1758 Mus musculus is the common house mouse. ... Binomial name Xenopus laevis Daudin, 1802 The African clawed frog (Xenopus laevis, also known as platanna) is a species of South African aquatic frog of the genus Xenopus. ... Subkingdom/Phyla Chytridiomycota Blastocladiomycota Neocallimastigomycota Glomeromycota Zygomycota Dikarya (inc. ... Binomial name Neurospora crassa Shear & B.O. Dodge Neurospora crassa is a type of red bread mold of the phylum Ascomycota. ... Typical orders Protostelia    Protosteliida Myxogastria    Liceida    Echinosteliida    Trichiida    Stemonitida    Physarida Dictyostelia    Dictyosteliida Slime mould (or slime mold) is a broad term often referring to roughly 6 groups of Eukaryotes. ... Families & Genera Dictyosteliidae     Dictyostelium     Polysphondylium     Coenonia Actyosteliidae     Acytostelium The dictyostelids are a group of cellular slime moulds. ... Orders Trypanosomatida Bodonida The kinetoplastids are a group of flagellate protozoa, including a number of parasites responsible for serious diseases in humans and other animals, as well as various forms found in soil and aquatic environments. ... Trypanosoma is a notable genus of trypanosomes, a monophyletic[1] group of unicellular parasitic protozoa. ... Crithidia is a genus of parasites that exist primarily in the intestines of invertebrates. ... Classes Karyorelictea Heterotrichea Spirotrichea Litostomatea Phyllopharyngea Nassophorea Colpodea Prostomatea Oligohymenophorea Plagiopylea See text for subclasses. ... Species T hegewischi Tetrahymena are non-pathogenic free-living ciliate protozoa. ... Species Paramecium tetraurelia Paramecium aurelia Paramecium caudatum The Paramecium is a group of unicellular ciliate protozoa formerly known as slipper animalcules from their slipper shape. ... Kingdom: Protista Phylum: Alveolata A type of ciliate whose cilia are grouped into cirri. ... Classes & Subclasses Aconoidasida Haemosporasina Piroplasmasina Blastocystea Conoidasida Coccidiasina Gregarinasina The Apicomplexa are a large group of protists, characterized by the presence of a unique organelle called an apical complex. ... Species Plasmodium achiotense Plasmodium achromaticum Plasmodium acuminatum Plasmodium adunyinkai Plasmodium aegyptensis Plasmodium aeuminatum Plasmodium agamae Plasmodium anasum Plasmodium anomaluri Plasmodium arachniformis Plasmodium ashfordi Plasmodium atheruri Plasmodium aurulentum Plasmodium australis Plasmodium attenuatum Plasmodium azurophilum Plasmodium balli Plasmodium bambusicolai Plasmodium basilisci Plasmodium beebei Plasmodium beltrani Plasmodium berghei Plasmodium bertii Plasmodium bigueti Plasmodium... For other uses, see Plant (disambiguation). ... Binomial name Arabidopsis thaliana (L.) Heynh. ... Divisions Chlorophyta Charophyta Streptophytina (Subdivision) The green algae are the large group of algae from which the embryophytes (higher plants) emerged. ... Species See text. ... Orders Subclass Apterygota Archaeognatha (bristletails) Thysanura (silverfish) Subclass Pterygota Infraclass Paleoptera (Probably paraphyletic) Ephemeroptera (mayflies) Odonata (dragonflies and damselflies) Infraclass Neoptera Superorder Exopterygota Grylloblattodea (ice-crawlers) Mantophasmatodea (gladiators) Plecoptera (stoneflies) Embioptera (webspinners) Zoraptera (angel insects) Dermaptera (earwigs) Orthoptera (grasshoppers, etc) Phasmatodea (stick insects) Blattodea (cockroaches) Isoptera (termites) Mantodea (mantids) Psocoptera... Binomial name Bombyx mori Linnaeus, 1758 “Silkworm” redirects here. ... Classes Adenophorea    Subclass Enoplia    Subclass Chromadoria Secernentea    Subclass Rhabditia    Subclass Spiruria    Subclass Diplogasteria The roundworms or nematodes (Phylum Nematoda from Gr. ... Binomial name Ascaris lumbricoides Ascaris lumbricoides is a human parasitic roundworm, which causes the disease of ascariasis. ... Typical divisions Ascomycota (sac fungi) Saccharomycotina (true yeasts) Taphrinomycotina Schizosaccharomycetes (fission yeasts) Basidiomycota (club fungi) Urediniomycetes Sporidiales Yeasts are a growth form of eukaryotic microorganisms classified in the kingdom Fungi, with approximately 1,500 species described. ... Binomial name Schizosaccharomyces pombe Schizosaccharomyces pombe, also called fission yeast, is a species of yeast. ... Typical divisions Ascomycota (sac fungi) Saccharomycotina (true yeasts) Taphrinomycotina Schizosaccharomycetes (fission yeasts) Basidiomycota (club fungi) Urediniomycetes Sporidiales Yeasts are a growth form of eukaryotic microorganisms classified in the kingdom Fungi, with approximately 1,500 species described. ... Binomial name Meyen ex E.C. Hansen Saccharomyces cerevisiae is a species of budding yeast. ... Binomial name Candida glabrata (Anderson) Meyer & Yarrow Candida glabrata is a haploid yeast of the genus Candida, previously known as Torulopsis glabrata. ... Binomial name Candida albicans (C.P. Robin) Berkhout 1923 Synonyms Candida stellatoidea [1] Candida albicans is a diploid asexual fungus (a form of yeast), and a causal agent of opportunistic oral and vaginal infections in humans. ... Binomial name Candida tropicalis Berkhout, 1923[1] Candida tropicalis is a species of yeast in the genus Candida. ... Binomial name Van der Walt, 1971[1] Synonyms Kluyveromyces fragilis Kluyveromyces cicerisporus Candida pseudotropicalis Candida kefyr Kluyveromyces marxianus is a species of yeast in the genus Kluyveromyces, and is the sexual form (teleomorph) of Candida kefyr. ... Kluyveromyces lactis is a Kluyveromyces yeast commonly used for genetic studies and industrial applications. ...

Telomeres and cancer

Telomere maintenance activity is a hallmark in approximately 90% of cancers in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo. Telomerase is an enzyme that adds specific DNA sequence repeats (TTAGGG in all vertebrates) to the 3 (three prime) end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. ...


References

  • Joeng KS, Song EJ, Lee KJ, Lee J (2004). "Long lifespan in worms with long telomeric DNA". Nature Genetics 36 (6): 607-11. PMID 15122256. 
  • Juola, Frans A.; Haussmann, Mark F.; Dearborn, Donald C.; Vlek, Carol M. (2006): Telomere shortening in a long-lived marine bird: Cross-sectional analysis and test of an aging tool. Auk 123(3): 775–783. DIO: 10.1642/0004-8038(2006)123[775:TSIALM]2.0.CO;2 HTML abstract

The Auk is a quarterly journal and the official publication of the American Ornithologists Union, having been continuously published by that body since 1884. ... A digital object identifier (or DOI) is a standard for persistently identifying a piece of intellectual property on a digital network and associating it with related data, the metadata, in a structured extensible way. ...

Related papers

External links

  • Telomerase.org - free research abstracts list in PDF format.


  Results from FactBites:
 
Telomere - Wikipedia, the free encyclopedia (1260 words)
A telomere is a region of highly repetitive DNA at the end of a chromosome that functions as a disposable buffer.
Telomeres are extended by telomerases, specialized reverse transcriptase enzymes that are involved in synthesis of telomeres in humans and many other, but not all, organisms.
Telomeres shorten because of the lagging strand phenomenon that is exhibited during DNA replication in eukaryotes only.
Science--de Lange, et al. (1525 words)
Knowing that telomeres were threatened by loss in each cell division unless their repeated sequences were replenished by telomerase, Cooke speculated that this enzyme [then just discovered in a ciliated protozoan (2)] might not be active in normal somatic human cells.
Telomere-clock champions were also fortified by the consistent shortening of telomeres during cellular aging in culture and with aging of human tissues in vivo (5, 6).
Since the telomere barrier to proliferation does not manifest itself until many cell divisions have passed, this mechanism may not be useful for a small animal in which a 2-cm mass of misplaced cells could be life-threatening.
  More results at FactBites »


 

COMMENTARY     


Share your thoughts, questions and commentary here
Your name
Your comments
Please enter the 5-letter protection code

Want to know more?
Search encyclopedia, statistics and forums:

 


Lesson Plans | Student Area | Student FAQ | Reviews | Press Releases |  Feeds | Contact
The Wikipedia article included on this page is licensed under the GFDL.
Images may be subject to relevant owners' copyright.
All other elements are (c) copyright NationMaster.com 2003-5. All Rights Reserved.
Usage implies agreement with terms.